ID: 948222989_948222996

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 948222989 948222996
Species Human (GRCh38) Human (GRCh38)
Location 2:236288178-236288200 2:236288200-236288222
Sequence CCAGCTGAAGCAGGAACACACCC CACTGGTTCAGGAGGGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 32, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!