ID: 948226064_948226078

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 948226064 948226078
Species Human (GRCh38) Human (GRCh38)
Location 2:236310170-236310192 2:236310218-236310240
Sequence CCACCTTTGCCTTGGTTGACCTG CTGGGCCCAGGAGAAAAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 50, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!