|
Left Crispr |
Right Crispr |
| Crispr ID |
948228287 |
948228289 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236330243-236330265
|
2:236330265-236330287
|
| Sequence |
CCAAATTTGGCCTGTTGTCTGTT |
TTTTGCAAATAAAGTTTTATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 15, 3: 116, 4: 450} |
{0: 64, 1: 826, 2: 1323, 3: 1434, 4: 2057} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|