ID: 948229747_948229756

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 948229747 948229756
Species Human (GRCh38) Human (GRCh38)
Location 2:236341386-236341408 2:236341415-236341437
Sequence CCTGGTCCAGGCGTCTGCAGGGG GTGTGTTTGTAAAAGTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 217} {0: 1, 1: 1, 2: 9, 3: 24, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!