ID: 948229816_948229828

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 948229816 948229828
Species Human (GRCh38) Human (GRCh38)
Location 2:236341722-236341744 2:236341744-236341766
Sequence CCCCCCCATGTCTTCCAGCCTGT TGCTGTGTGTGGTGGGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 328} {0: 1, 1: 1, 2: 15, 3: 110, 4: 1235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!