|
Left Crispr |
Right Crispr |
Crispr ID |
948247609 |
948247612 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:236499548-236499570
|
2:236499569-236499591
|
Sequence |
CCTCCTGGGTAGCTGGGACTACA |
CAGGCGTGTGCCACCACCTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 833, 1: 44541, 2: 164491, 3: 223530, 4: 208480} |
{0: 1, 1: 192, 2: 4252, 3: 38293, 4: 136686} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|