|
Left Crispr |
Right Crispr |
| Crispr ID |
948247613 |
948247620 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236499579-236499601
|
2:236499614-236499636
|
| Sequence |
CCACCACCTCAGGCTAATTTTTG |
AGATGGGGGTTTCACCACACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 190, 2: 6028, 3: 63575, 4: 186837} |
{0: 2, 1: 35, 2: 215, 3: 1458, 4: 2733} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|