ID: 948247613_948247621

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 948247613 948247621
Species Human (GRCh38) Human (GRCh38)
Location 2:236499579-236499601 2:236499619-236499641
Sequence CCACCACCTCAGGCTAATTTTTG GGGGTTTCACCACACTGGCCAGG
Strand - +
Off-target summary {0: 3, 1: 190, 2: 6028, 3: 63575, 4: 186837} {0: 48, 1: 1791, 2: 15271, 3: 95826, 4: 167328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!