|
Left Crispr |
Right Crispr |
| Crispr ID |
948247614 |
948247619 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:236499582-236499604
|
2:236499600-236499622
|
| Sequence |
CCACCTCAGGCTAATTTTTGTAT |
TGTATTTTTAGTAGAGATGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 196, 2: 6096, 3: 58757, 4: 124685} |
{0: 1745, 1: 3705, 2: 3974, 3: 3918, 4: 4634} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|