ID: 948247615_948247622

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 948247615 948247622
Species Human (GRCh38) Human (GRCh38)
Location 2:236499585-236499607 2:236499623-236499645
Sequence CCTCAGGCTAATTTTTGTATTTT TTTCACCACACTGGCCAGGCTGG
Strand - +
Off-target summary {0: 46, 1: 1016, 2: 1756, 3: 1533, 4: 2484} {0: 86, 1: 2505, 2: 20744, 3: 122080, 4: 164588}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!