ID: 948303765_948303768

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 948303765 948303768
Species Human (GRCh38) Human (GRCh38)
Location 2:236931265-236931287 2:236931299-236931321
Sequence CCAGTTGTTTCCAGGCATAGTAG ACTTACTTGTTTGAATGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!