ID: 948337845_948337849

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 948337845 948337849
Species Human (GRCh38) Human (GRCh38)
Location 2:237224451-237224473 2:237224473-237224495
Sequence CCCTGCCCTGCAACAAAATTATT TTTCTGCTTTCACCAAACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 552} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!