ID: 948348524_948348528

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 948348524 948348528
Species Human (GRCh38) Human (GRCh38)
Location 2:237319481-237319503 2:237319519-237319541
Sequence CCCACCTCAGTCTGTTTGGGCAC CAGTGCAGCCAGAAAAAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 51, 3: 130, 4: 611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!