ID: 948355232_948355242

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 948355232 948355242
Species Human (GRCh38) Human (GRCh38)
Location 2:237372452-237372474 2:237372504-237372526
Sequence CCACTGTTAAAAGTCCAAGAAGT ATCAAAGAGAAGGGGAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 180} {0: 1, 1: 0, 2: 3, 3: 41, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!