|
Left Crispr |
Right Crispr |
| Crispr ID |
948358672 |
948358680 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:237401926-237401948
|
2:237401960-237401982
|
| Sequence |
CCTTCCACCTTAGCCTTCCTAAG |
CAGGCGTGAGCCACTGTGCACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 289, 3: 6579, 4: 63080} |
{0: 82, 1: 8196, 2: 44544, 3: 106541, 4: 136127} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|