ID: 948359768_948359771

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 948359768 948359771
Species Human (GRCh38) Human (GRCh38)
Location 2:237412020-237412042 2:237412046-237412068
Sequence CCACTCAGTGTCTGCTTCCTGGC TCTCGACCATGAGTGAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 740} {0: 1, 1: 1, 2: 0, 3: 3, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!