ID: 948385325_948385331

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 948385325 948385331
Species Human (GRCh38) Human (GRCh38)
Location 2:237577289-237577311 2:237577307-237577329
Sequence CCGTCTTGTTGCCCACCAGCATC GCATCACCAGGACTTCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 221} {0: 1, 1: 0, 2: 1, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!