ID: 948389692_948389693

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 948389692 948389693
Species Human (GRCh38) Human (GRCh38)
Location 2:237603021-237603043 2:237603034-237603056
Sequence CCAGGTGGACAGTGTTAGAATTG GTTAGAATTGAACACCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 62, 3: 261, 4: 578} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!