ID: 948424075_948424092

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 948424075 948424092
Species Human (GRCh38) Human (GRCh38)
Location 2:237876873-237876895 2:237876925-237876947
Sequence CCATCCCCAGGTACCCGTGGAAC CTCTCATGCTGCCCATGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120} {0: 1, 1: 1, 2: 2, 3: 15, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!