ID: 948429304_948429309

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 948429304 948429309
Species Human (GRCh38) Human (GRCh38)
Location 2:237909072-237909094 2:237909091-237909113
Sequence CCCCATGGGGCAAGGGCTCATTC ATTCAAGGCTCTCTGGCTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 142} {0: 1, 1: 0, 2: 0, 3: 22, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!