ID: 948436645_948436651

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 948436645 948436651
Species Human (GRCh38) Human (GRCh38)
Location 2:237958196-237958218 2:237958211-237958233
Sequence CCGTCCCGACCATCACTGATGCT CTGATGCTCCAAATTTGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!