|
Left Crispr |
Right Crispr |
| Crispr ID |
948450435 |
948450447 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:238067018-238067040
|
2:238067063-238067085
|
| Sequence |
CCTCCCACCGGGTCCCTCTGATG |
AATTCAAGATGAGATTTGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 11, 2: 243, 3: 1509, 4: 3324} |
{0: 7468, 1: 11239, 2: 9760, 3: 8452, 4: 6791} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|