ID: 948450827_948450831

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 948450827 948450831
Species Human (GRCh38) Human (GRCh38)
Location 2:238070161-238070183 2:238070192-238070214
Sequence CCAAAAGGGAGTGACATGTTCAC GATCATTAACTTGTAAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 135} {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!