|
Left Crispr |
Right Crispr |
| Crispr ID |
948453853 |
948453855 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:238095164-238095186
|
2:238095217-238095239
|
| Sequence |
CCAGCTTGGGTGACAGAGTGAGT |
CAAAAATAACTGGCAGAGTAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 15, 1: 1651, 2: 36020, 3: 88602, 4: 163922} |
{0: 1, 1: 0, 2: 2, 3: 31, 4: 364} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|