ID: 948469379_948469390

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 948469379 948469390
Species Human (GRCh38) Human (GRCh38)
Location 2:238167455-238167477 2:238167482-238167504
Sequence CCAGCCAGGGCCCCTACCTGGGA GTCAGCTGACGCAGGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 318} {0: 1, 1: 0, 2: 1, 3: 22, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!