ID: 948483951_948483956

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 948483951 948483956
Species Human (GRCh38) Human (GRCh38)
Location 2:238268212-238268234 2:238268253-238268275
Sequence CCACGCTCTAAGTTGGGAACTGT TGTTCTGTTCCCTCCTCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} {0: 1, 1: 0, 2: 4, 3: 42, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!