ID: 948484359_948484365

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948484359 948484365
Species Human (GRCh38) Human (GRCh38)
Location 2:238271167-238271189 2:238271184-238271206
Sequence CCTTTGCCAGAGCAGGCAGCTGG AGCTGGCGGCCCCCACAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 307} {0: 1, 1: 0, 2: 2, 3: 13, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!