ID: 948496409_948496424

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 948496409 948496424
Species Human (GRCh38) Human (GRCh38)
Location 2:238352553-238352575 2:238352587-238352609
Sequence CCAGGTGTGGACCAGGAGGCCTG GACGTGGGGAAGCTGGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 331} {0: 1, 1: 1, 2: 3, 3: 44, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!