ID: 948505449_948505459

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 948505449 948505459
Species Human (GRCh38) Human (GRCh38)
Location 2:238424596-238424618 2:238424640-238424662
Sequence CCTGGAGGGGCAAGACAGCCCAC GTGCTGGGCTGGGATGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!