ID: 948506931_948506935

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 948506931 948506935
Species Human (GRCh38) Human (GRCh38)
Location 2:238434814-238434836 2:238434859-238434881
Sequence CCTTCTTTTACTCAGGCTCAGGG CCCATTGCTATTTGCTTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 185} {0: 1, 1: 0, 2: 1, 3: 13, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!