ID: 948549994_948550000

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 948549994 948550000
Species Human (GRCh38) Human (GRCh38)
Location 2:238764960-238764982 2:238764973-238764995
Sequence CCCAGTCTCCACGCCTTCTTAGC CCTTCTTAGCAGGAGTGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!