ID: 948560580_948560594

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 948560580 948560594
Species Human (GRCh38) Human (GRCh38)
Location 2:238848763-238848785 2:238848815-238848837
Sequence CCGCTGCGGGGGGCGGGCGGCAG TCTCCTCGGCGAGGCCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 280} {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!