ID: 948563326_948563334

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 948563326 948563334
Species Human (GRCh38) Human (GRCh38)
Location 2:238868096-238868118 2:238868129-238868151
Sequence CCAGTGCAGTGCCCCACAAAGGT ACACATCAGCCCCGTGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 127} {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!