ID: 948591641_948591649

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 948591641 948591649
Species Human (GRCh38) Human (GRCh38)
Location 2:239054279-239054301 2:239054306-239054328
Sequence CCTTGCACCCAGGACCTGCTGCT GGTCGGTGCCAGAACTCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 376} {0: 1, 1: 0, 2: 0, 3: 4, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!