ID: 948592181_948592186

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 948592181 948592186
Species Human (GRCh38) Human (GRCh38)
Location 2:239058089-239058111 2:239058109-239058131
Sequence CCTGGGTGCTCTGTGTCTACTCT TCTGGCACCCTAATTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 224} {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!