ID: 948592421_948592428

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 948592421 948592428
Species Human (GRCh38) Human (GRCh38)
Location 2:239059913-239059935 2:239059927-239059949
Sequence CCACCAGCCTGCAGGAGAGCTCT GAGAGCTCTCCGGGGGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 285} {0: 1, 1: 0, 2: 3, 3: 14, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!