ID: 948593270_948593285

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 948593270 948593285
Species Human (GRCh38) Human (GRCh38)
Location 2:239064451-239064473 2:239064491-239064513
Sequence CCACCTCCGCCGTCTCTGATGCT CAACAGAAGGGGAGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 226} {0: 1, 1: 0, 2: 11, 3: 149, 4: 1542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!