ID: 948596583_948596594

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 948596583 948596594
Species Human (GRCh38) Human (GRCh38)
Location 2:239083290-239083312 2:239083311-239083333
Sequence CCCAGGCACTCCTACCTGCTCCC CCTTAGGAGGAGCTGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 312} {0: 1, 1: 0, 2: 4, 3: 73, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!