ID: 948601746_948601754

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 948601746 948601754
Species Human (GRCh38) Human (GRCh38)
Location 2:239111463-239111485 2:239111492-239111514
Sequence CCCCGCGCTGTGCCCACTGTGGC TGCACCCTCAGGCTGCACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 285} {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!