ID: 948625398_948625405

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 948625398 948625405
Species Human (GRCh38) Human (GRCh38)
Location 2:239265195-239265217 2:239265214-239265236
Sequence CCACATGTGTGCCAACCCCAGGA AGGATGGGTCCAGCACACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197} {0: 1, 1: 0, 2: 0, 3: 9, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!