ID: 948627834_948627847

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 948627834 948627847
Species Human (GRCh38) Human (GRCh38)
Location 2:239279996-239280018 2:239280042-239280064
Sequence CCCTTCCACTCCTGCGGAAGAGG GCCTGTGTTTCCTAGCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 127} {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!