ID: 948628325_948628334

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 948628325 948628334
Species Human (GRCh38) Human (GRCh38)
Location 2:239284364-239284386 2:239284405-239284427
Sequence CCTGAGCCACTGTGCTGACCCAG TCCATCACGGGGACCCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 433} {0: 1, 1: 0, 2: 0, 3: 9, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!