ID: 948628325_948628339

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 948628325 948628339
Species Human (GRCh38) Human (GRCh38)
Location 2:239284364-239284386 2:239284414-239284436
Sequence CCTGAGCCACTGTGCTGACCCAG GGGACCCTCCGCGGGGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 63, 4: 433} {0: 1, 1: 0, 2: 2, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!