|
Left Crispr |
Right Crispr |
| Crispr ID |
948633835 |
948633842 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:239321205-239321227
|
2:239321220-239321242
|
| Sequence |
CCTGTAATCCCGGCACTTTGGAA |
CTTTGGAAGGTGAAGGTGGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 98, 1: 12506, 2: 305838, 3: 263550, 4: 146364} |
{0: 5, 1: 125, 2: 2466, 3: 32371, 4: 113275} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|