ID: 948638844_948638847

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 948638844 948638847
Species Human (GRCh38) Human (GRCh38)
Location 2:239360424-239360446 2:239360442-239360464
Sequence CCTTCAGGGTCTGCCCAGGCACC GCACCCTGCCTTCCTGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 282} {0: 1, 1: 0, 2: 3, 3: 61, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!