ID: 948640796_948640805

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 948640796 948640805
Species Human (GRCh38) Human (GRCh38)
Location 2:239375006-239375028 2:239375054-239375076
Sequence CCTGGACGGGTGGGTGTGAGCTA GGGCAGGAAGGGCAGCCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105} {0: 1, 1: 0, 2: 2, 3: 58, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!