ID: 948640796_948640806

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 948640796 948640806
Species Human (GRCh38) Human (GRCh38)
Location 2:239375006-239375028 2:239375055-239375077
Sequence CCTGGACGGGTGGGTGTGAGCTA GGCAGGAAGGGCAGCCGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105} {0: 1, 1: 0, 2: 3, 3: 62, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!