ID: 948642886_948642900

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 948642886 948642900
Species Human (GRCh38) Human (GRCh38)
Location 2:239386480-239386502 2:239386521-239386543
Sequence CCCGGGGTGGCCGGCCAGGGGAG CCCACGGATGTTGGTGGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 338} {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!