ID: 948700488_948700497

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 948700488 948700497
Species Human (GRCh38) Human (GRCh38)
Location 2:239756702-239756724 2:239756753-239756775
Sequence CCCCCAAAGCCTGGACTCCTGGG CAGTCTTATTTCAGAGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 317} {0: 1, 1: 0, 2: 1, 3: 26, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!