ID: 948725854_948725859

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 948725854 948725859
Species Human (GRCh38) Human (GRCh38)
Location 2:239933453-239933475 2:239933470-239933492
Sequence CCTGCCACCACTGCTGTAGGCTG AGGCTGGGACAGCCAAGCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 317} {0: 1, 1: 0, 2: 7, 3: 36, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!